In combination with eurogentec primers and probes it gives highly specific and sensitive results. Products for abi geneamp 5700, abi prism sds 7000, 7300. Sybr green pcr master mix and rtpcr reagents protocol pn. The 5700 system has single wavelength color detection fam or sybr. Sybr green pcr master mix thermo fisher scientific.
Applied biosystems geneamp 5700 sequence detection system. Aug 19, 2004 the abi geneamp system 2700 is a simple, inexpensive, thermal cycler with a small footprint. Colorimetric detection of hepatitis e virus based on reverse. Amperase, amplitaq gold, geneamp, and taqman are registered trademarks of roche. Quantitative realtime pcr using taqman and sybr green for. Applied biosystems geneamp 5700 used with warranty. Rapid detection and quantification of members of the. Optimized for use with amplitaq dna polymerase, offering maximum pcr performance available in several convenient sizesgeneamp 10x pcr buffer i contains 15 mm mgcl2. Please contact us if you have any questions 9196071733. View online or download applied biosystems 7500 fast installation and maintenance manual, getting started. The genotype was determined from the ct values obtained with the geneamp 5700 sds. The abi 5700 with the geneamp 5700 sds software, version 1. For use with equipment 2720 thermal cycler, 3xl genetic analyzer, 3500xl dx genetic analyzer, 3730xl dna.
Evaluation of universal probes and primer sets for. Geneamp 5700 sequence detection system users the 5700 sequence detection system automatically optimizes the ccd camera exposure time throughout a realtime pcr run. Geneamp 5700 sequence detection system sds software. Data acquisition and subsequent analysis were performed with abi prism 7000 sds software applied biosystems. Four hev positive specimens and four hev negative specimens were analyzed by rtpcr fig. User bulletin abi prism 7700 and geneamp 5700 sequence. We have also performed pcr amplification and melting analysis in a 96well format on the cheaper thermal cyclers, abi geneamp 5700 and abi prism 7000 sequence detection systems applied biosystems with comparable results data not shown.
Description applied biosystems abi geneamp pcr system. International buyers must arrange for their own shipping. It is a less table 1 realtime pcr instruments max sample company pcr system sample format number applied biosystems abi prism 7700 sds microplate 96. Simultaneous detection of the main black aspergilli responsible for ota contamination in grapes by multiplex realtime pcr. The small footprint means that this device makes good use of available bench space, allowing this device to fit into any laboratory it will even fit easily on the researchers personal work bench. The reaction was performed using the abi prism 7000 sequence detection system foster city, ca. The 5700 sds differs from the 7700 sds in system, diminishing the chances of contamination. Abi prism and its design, applied biosystems, and microamp are registered trademarks of applera corporation or its subsidiaries in the u. Print bookmark share pdf 337kb english format file size. Item is used and is untested other than what is indicated below. Pcr was carried out on a geneamp 5700 sequence detector with an enzyme heatactivation step of 12 min at 95c, followed by 45 cycles of twostep amplification 30 seconds at 95c, 30 seconds at 58c and an onboard dissociation run from 60c to 95c. Age and sexdependent association between fto rs9939609 and. The electrical receptacle must be located within 1.
Evaluation of universal probes and primer sets for assessing. Pcr results were given as the increase in the fluorescence signal of the reporter dye detected and visualized by the geneamp 5700 sds software provided with the geneamp 5700 sds applied biosystems. The artus cmv tm pcr kit may neither be used in combination with the geneamp 5700 sds nor with the 384 plate format of the abi prism 7900ht sds. Sybr green pcr master mix and rtpcr reagents protocol. Abi prism 7700 sequence detection system sds, the abi prism 7900ht sds, the abi prism 7000 sds, or the geneamp 5700 sds. Geneamp pcr system 9700 laboratory equipment pdf manual download. In the current study, we used the geneamp sequence detection system with taqman and. The system can also be used with a single 96well plate for smaller runs. This pcr thermal cycler has exceptional heating and cooling uniformity for high quality results, in a very small space. Consisting of dna cycler 9600 and sequence detector 5700. A new realtime pcr procedure was developed for the specific detection and quantification of leuconostoc mesenteroides in meat products. Applied biosystems microamp optical 96well reaction plate. Pdf simultaneous detection of the main black aspergilli. Sybr green pcr master mix and rtpcr yale school of.
Highfat dietinduced changes in liver thioredoxin and. Applied biosystems 7900ht fast realtime pcr system and sds. The data were analyzed by geneamp 5700 sds software. Applied biosystems sybr green pcr master mix combines sybr green i dye, amplitaq. Pcr and fluorescence signal monitoring were performed with the geneamp 5700 sequence detection system pe applied biosystems. Dna extracted from prevotella nigrescens atcc 33563 was used to establish the standard curve, based on a series of 10fold dilutions. Analysis of liver trx1trxr1 sacylation acylbiotin exchange assay 17 was used with slight modi. Applied biosystems geneamp pcr system 9700 user manual pdf. The electrical supply 4 electrical outlets should have a dedicated 2. Please contact us if you have any questions 9196071733 jeff.
The 96well geneamp pcr system 9700 contains two sample blocks, each of which holds a maximum of 96 sample wells. View and download applied biosystems geneamp pcr system 9700 user manual online. Age and sexdependent association between fto rs9939609. The genotype was determined from the cycle threshold ct values obtained with the geneamp 5700 sds software. M, respectively and the concentration of the rdna template was.
Everything you need for sybr green dyebased pcr amplification and detection in a convenient, singletube format. For the best quantitation results, use the following. Abi geneamp pcr system 2700 with manual call enterprises. C t values threshold cycle represent the pcr cycle in which an increase in fluorescence, over a defined threshold, first occurred, for each. Eurogentec products for abi geneamp 5700, abi prism sds. Measured values were analysed using the system integrated geneamp 5700 sds software abi. Research article open access the common rs9939609 variant of. Interchangeable well blocks give your lab a modular solution to your application needs. Powers on, software runs os 9 edition, diagnostics point towards a laser problem.
Geneamp pcr system 2700 thermo fisher scientific us. Reaction mixtures for the fluorogenic pcr were prepared in which the concentrations of each primer and the taqman probe were optimized 0. Highthroughput snp genotyping by singletube pcr with tm. Normalization procedures and analyses were carried out with. For use with equipment 2720 thermal cycler, 3xl genetic analyzer, 3500xl dx genetic analyzer, 3730xl dna analyzer, 6100 nucleic acid prepstation, 6100 thermal cycler, 7000 system, 7300 system, 7500 system, 7900ht system, geneamp 9700, quantstudio, simpliamp thermal cycler, veriti dx thermal cycler. Sybr green pcr master mix pe applied biosystems, 20 pmol of. Truescience respifinder pathogen identification panels. Short interfering rna sirna smartpool sequences were obtained from dharmaconthermo fisher scienti. Applied biosystems 7900ht fast realtime pcr system thermo. The 5700 system has single wavelength color detection fam or sybr and includes a 9600 thermal cycler. Pcr results were given as the increase in the fluorescence signal of the reporter dye detected and visualized by the geneamp 5700 sds software provided with the geneamp 5700 sds applied. Evaluation of universal probes and primer sets for assessing total bacterial load in clinical samples.
Products for abi geneamp 5700, abi prism sds 7000, 7300, 7700, 7900 the qpcr mastermixes and core kits for probe and sybr green i containing rox passive reference, have been specially optimized for the use on the abi geneamp 5700, abi prism sds 7000, 7300, 7700, 7900, stepone and mastercycler ep realplex. The primers in the neomycin gene were tgctcctgccgagaaagtatc and gccggatcaagcgtatgc. Circannual changes in the expression of vascular endothelial. Applied biosystems geneamp 10x pcr buffer i is optimized for use with amplitaq dna polymerase, resulting in robust pcr amplification. The genotype was determined from the ct values obtained with the geneamp 5700 sds software. Geneamp 5700 sequence detection system sds software v. The abi geneamp system 2700 is a simple, inexpensive, thermal cycler with a small footprint. Abi prism 7000, 7700, 7900ht, abi 7300 qpcr systems, geneamp 5700, stepone, and the steponeplus hsm400. Taqman onestep rtpcr master mix reagents kit protocol pn.
Twostep thermal cycling was performed by using the geneamp 9600 pcr system perkinelmer, foster city, calif. Abi 7500 qpcr systems, viia 7, quantstudio 12k flex, agilent mx3000p mx3005p and mx4000 hsm400lr. Please refer to the abi prism 7900ht sequence detection system and sds enterprise database user guide, the abi prism 7000 sequence detection system user guide, the abi prism 7700 sequence detection system users manual, the geneamp 5700 sequence detection system users manual. The proteasome inhibitor ps341 overcomes trail resistance in bax and caspase 9negative or bclxl overexpressing cells. Do not launch the geneamp 5700 sds software at this time. Perkin elmer geneamp 9600, abi prism 310 repair help. Allow the computer to complete the bootup sequence. Applied biosystems geneamp 5700 23427 in burladingen, germany. Primer express software for primer design applied biosystems reagents applied biosystems universal thermal cycling conditions about this protocol. Absence of primer dimers was controlled for by postpcr melting curve analysis according to the manufacturers recommendations abi.
Sequence detection systems abi prism 7900ht, 7000, 7700. The proteasome inhibitor ps341 overcomes trail resistance. Triad perkin elmer abi geneamp 9600 5700 real time pcr. General implications and practical use in endodontic antimicrobial therapy. Perkin elmer geneamp 9600, abi prism 310 repair help showing 1 of messages. Results were analyzed using geneamp 5700 sds software perkin elmer applied biosystems. The threshold value ct was defined as 01 on the log scale and fluorescence values from cycles six. Therefore, no adjustment is required when using the optical adhesive cover on this system. The cells were transfected with25nmoll sirnaprkaa2,sirnaprkab1,sirna. Rapid detection and quantification of members of the archaeal. For use with the prism 7000abi 7700, and 7900ht sequence detection systemsfor the quantitative detection of cmv dna from edta plasma. Perkin elmer abi geneamp 9600 5700 real time pcr with 5700 sequence detection system is a system for realtime quantitative pcr. The abi geneamp pcr system 9700 is a flexible high throughput thermal cycler.
The small footprint means that this device makes good use of available bench space. Sequence detection systems thermo fisher scientific. We have also performed pcr amplification and melting analysis in a 96well format on the cheaper thermal cyclers, abi geneamp 5700 and abi prism 7000 sequence detection systems applied. Applied biosystems geneamp 5700 sequence detection system w 5700 power supply.
702 1072 836 1011 518 161 976 600 255 1389 421 416 495 978 1171 932 1157 80 646 263 1310 907 134 362 536 1282 630 113 1007 593 1117 563 728 1271 138 1180 1504 61 14 168 943 236 270 1468 1069 585 980 380 472